A cluster randomized controlled trial comparing Virtual Learning Collaborative and Technical Assistance strategies to implement an early palliative care program for patients with advanced cancer and their caregivers: a study protocol

A cluster randomized controlled trial comparing Virtual Learning Collaborative and Technical Assistance strategies to implement an early palliative care program for patients with advanced cancer and their caregivers: a study protocol
Virtual Learning Collaboratives (VLC), studying communities centered on a widespread objective, are used incessantly in healthcare settings to implement finest practices. Yet, there may be restricted analysis testing the effectiveness of this strategy in contrast to different implementation strategies. This study evaluates the effectiveness of a VLC in contrast to Technical Assistance (TA) amongst neighborhood oncology practices implementing ENABLE (Educate, Nurture, Advise, Before Life Ends), an evidence-based, early palliative care telehealth, psycho-educational intervention for patients with newly identified advanced cancer and their caregivers.
 Using Reach, Effectiveness, Adoption, Implementation, Maintenance (RE-AIM) and Proctor’s Implementation Outcomes Frameworks, this two-arm hybrid type-III cluster-randomized controlled trial (RCT) will evaluate two implementation strategies, VLC versus TA, among the many 48 National Cancer Institute Community Oncology Research Program (NCORP) observe clusters that haven’t traditionally supplied palliative care to all patients with advanced cancer. Three cohorts of observe clusters shall be randomized to the study arms. Each observe cluster will recruit 15-27 patients and a household caregiver to take part in ENABLE.
The main study consequence is ENABLE uptake (affected person degree), i.e., the proportion of eligible patients who full the ENABLE program (obtain a palliative care evaluation and full the six ENABLE classes over 12 weeks). The secondary consequence is general program implementation (observe cluster degree), as measured by the General Organizational Index at baseline, 6, and 12 months. Exploratory goals assess affected person and caregiver temper and high quality of life outcomes at baseline, 12, and 24 weeks. Practice cluster randomization will search to maintain the proportion of rural practices, observe sizes, and minority patients seen inside every observe
This study will advance the sphere of implementation science by evaluating VLC effectiveness, a generally used however understudied, implementation technique. The study will advance the sphere of palliative care by constructing the capability and infrastructure to implement an early palliative care program in neighborhood oncology practices. The LARS rating is an internationally well-accepted questionnaire to assess low anterior resection syndrome, however at the moment there isn’t any formally validated Italian model.
The English model of the LARS rating was translated into Italian following the forward-and-back translation course of. A whole of 147 patients crammed out our model. Among them, 40 patients answered the questionnaire twice for the test-retest reliability part. The validity of the LARS rating was examined utilizing convergent and discriminant validity indicators by correlating the EORTC QLQ-C30 and QLQ-CR29 questionnaires. The LARS rating functionality to differentiate teams of patients with totally different demographic or medical options was additionally assessed.

Performance Characteristics of the Ultrasound Strategy throughout Incidence Screening within the UK Collaborative Trial of Ovarian Cancer Screening (UKCTOCS)

Randomised controlled trials of ovarian cancer (OC) screening haven’t but demonstrated an affect on illness mortality. Meanwhile, the screening information from medical trials represents a wealthy useful resource to perceive the efficiency of modalities used. We report right here on incidence screening within the ultrasound arm of UKCTOCS. 44,799 of the 50,639 girls who had been randomised to annual screening with transvaginal ultrasound attended annual incidence screening between 28 April 2002 and 31 December 2011. Transvaginal ultrasound was used each as the primary and the second line check. Participants had been adopted up by way of digital well being report linkage and postal questionnaires.

Out of 280,534 annual incidence screens, 960 girls underwent screen-positive surgical procedure. 113 had ovarian/tubal cancer (80 invasive epithelial). Of the screen-detected invasive epithelial cancers, 37.5% (95% CI: 26.9-49.0) had been Stage I/II. An extra 52 (50 invasive epithelial) had been identified inside one yr of their final display screen. Of the 50 interval epithelial cancers, 6.0% (95% CI: 1.3-16.5) had been Stage I/II. For detection of all ovarian/tubal cancers identified inside one yr of display screen, the sensitivity, specificity, and optimistic predictive values had been 68.5% (95% CI: 60.8-75.5), 99.7% (95% CI: 99.7-99.7), and 11.8% (95% CI: 9.8-14) respectively.

When the evaluation was restricted to invasive epithelial cancers, sensitivity, specificity and optimistic predictive values had been 61.5% (95% CI: 52.6-69.9); 99.7% (95% CI: 99.7-99.7) and 8.3% (95% CI: 6.7-10.3), with 12 surgical procedures per display screen optimistic. The low sensitivity coupled with the advanced stage of interval cancers means that ultrasound scanning as the primary line check may not be appropriate for inhabitants screening for ovarian cancer. Trial registration: ISRCTN22488978. Registered on 6 April 2000.

A cluster randomized controlled trial comparing Virtual Learning Collaborative and Technical Assistance strategies to implement an early palliative care program for patients with advanced cancer and their caregivers: a study protocol

The Florida Pancreas Collaborative Next-Generation Biobank: Infrastructure to Reduce Disparities and Improve Survival for a Diverse Cohort of Patients with Pancreatic Cancer

Well-annotated, high-quality biorepositories present a priceless platform to assist translational analysis. However, most biorepositories have poor illustration of minority teams, limiting the power to deal with well being disparities. Methods: We describe the institution of the Florida Pancreas Collaborative (FPC), the primary state-wide potential cohort study and biorepository designed to deal with the upper burden of pancreatic cancer (PaCa) in African Americans (AA) in contrast to Non-Hispanic Whites (NHW) and Hispanic/Latinx (H/L).

We present an overview of stakeholders; study eligibility and design; recruitment strategies; customary working procedures to accumulate, course of, retailer, and switch biospecimens, medical photographs, and information; our cloud-based information administration platform; and progress relating to recruitment and biobanking. Results: The FPC consists of multidisciplinary groups from fifteen Florida medical establishments.

USP45 Polyclonal Antibody

ES7798-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against USP45 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

USP45 Polyclonal Antibody

ES7798-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against USP45 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

USP45 Rabbit pAb

A5074-100ul 100 ul
EUR 308

USP45 Rabbit pAb

A5074-200ul 200 ul
EUR 459

USP45 Rabbit pAb

A5074-20ul 20 ul Ask for price

USP45 Rabbit pAb

A5074-50ul 50 ul Ask for price

USP45 antibody

70R-21212 50 ul
EUR 435
Description: Rabbit polyclonal USP45 antibody

USP45 Antibody

35125-100ul 100ul
EUR 252

USP45 Antibody

35125-50ul 50ul
EUR 187

USP45 Antibody

42822-100ul 100ul
EUR 252

USP45 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

USP45 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USP45 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

USP45 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USP45 Antibody

DF4595 200ul
EUR 304
Description: USP45 Antibody detects endogenous levels of total USP45.

USP45 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

USP45 Antibody

CSB-PA226027-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

USP45 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

USP45 Antibody

ABD4595 100 ug
EUR 438

Anti-USP45 Antibody

A09878 100ul
EUR 397
Description: Rabbit Polyclonal USP45 Antibody. Validated in WB and tested in Human.

USP45 Conjugated Antibody

C42822 100ul
EUR 397

anti- USP45 antibody

FNab09335 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:50-1:500
  • Immunogen: ubiquitin specific peptidase 45
  • Uniprot ID: Q70EL2
  • Gene ID: 85015
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP45

Anti-USP45 antibody

PAab09335 100 ug
EUR 386

Anti-USP45 antibody

STJ27068 100 µl
EUR 277
Description: The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1.

Anti-USP45 antibody

STJ96207 200 µl
EUR 197
Description: Rabbit polyclonal to USP45.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26759 50 ul
EUR 334
Description: Mouse polyclonal to USP45

USP45 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

USP45 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

USP45 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

USP45 Blocking Peptide

DF4595-BP 1mg
EUR 195

USP45 cloning plasmid

CSB-CL741097HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 870
  • Sequence: atgcgggtgaaagatccaactaaagctttacctgagaaagccaaaagaagtaaaaggcctactgtacctcatgatgaagactcttcagatgatattgctgtaggtttaacttgccaacatgtaagtcatgctatcagcgtgaatcatgtaaagagagcaatagctgagaatctgtg
  • Show more
Description: A cloning plasmid for the USP45 gene.

Anti-USP45 (1H2)

YF-MA11709 100 ug
EUR 363
Description: Mouse monoclonal to USP45


EF004142 96 Tests
EUR 689

Mouse USP45 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human USP45 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

USP45 Recombinant Protein (Rat)

RP236123 100 ug Ask for price

USP45 Recombinant Protein (Human)

RP034135 100 ug Ask for price

USP45 Recombinant Protein (Mouse)

RP183461 100 ug Ask for price

Ubiquitin Specific Peptidase 45 (USP45) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody

abx027390-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody

abx027390-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody

abx219223-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody

abx239335-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody

abx331224-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Usp45 ORF Vector (Mouse) (pORF)

ORF061155 1.0 ug DNA
EUR 506

Usp45 ORF Vector (Rat) (pORF)

ORF078709 1.0 ug DNA
EUR 506

USP45 ORF Vector (Human) (pORF)

ORF011379 1.0 ug DNA
EUR 95

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Usp45 sgRNA CRISPR Lentivector set (Rat)

K6312801 3 x 1.0 ug
EUR 339

USP45 sgRNA CRISPR Lentivector set (Human)

K2601401 3 x 1.0 ug
EUR 339

Usp45 sgRNA CRISPR Lentivector set (Mouse)

K4552901 3 x 1.0 ug
EUR 339

Usp45 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6312802 1.0 ug DNA
EUR 154

Usp45 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6312803 1.0 ug DNA
EUR 154

Usp45 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6312804 1.0 ug DNA
EUR 154

USP45 sgRNA CRISPR Lentivector (Human) (Target 1)

K2601402 1.0 ug DNA
EUR 154

USP45 sgRNA CRISPR Lentivector (Human) (Target 2)

K2601403 1.0 ug DNA
EUR 154

USP45 sgRNA CRISPR Lentivector (Human) (Target 3)

K2601404 1.0 ug DNA
EUR 154

Usp45 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4552902 1.0 ug DNA
EUR 154

Usp45 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4552903 1.0 ug DNA
EUR 154

Usp45 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4552904 1.0 ug DNA
EUR 154

USP45 Protein Vector (Mouse) (pPB-C-His)

PV244618 500 ng
EUR 1065

USP45 Protein Vector (Mouse) (pPB-N-His)

PV244619 500 ng
EUR 1065

USP45 Protein Vector (Mouse) (pPM-C-HA)

PV244620 500 ng
EUR 1065

USP45 Protein Vector (Mouse) (pPM-C-His)

PV244621 500 ng
EUR 1065

USP45 Protein Vector (Rat) (pPB-C-His)

PV314834 500 ng
EUR 603

USP45 Protein Vector (Rat) (pPB-N-His)

PV314835 500 ng
EUR 603

USP45 Protein Vector (Rat) (pPM-C-HA)

PV314836 500 ng
EUR 603

USP45 Protein Vector (Rat) (pPM-C-His)

PV314837 500 ng
EUR 603

USP45 Protein Vector (Human) (pPB-C-His)

PV045513 500 ng
EUR 329

USP45 Protein Vector (Human) (pPB-N-His)

PV045514 500 ng
EUR 329

USP45 Protein Vector (Human) (pPM-C-HA)

PV045515 500 ng
EUR 329

USP45 Protein Vector (Human) (pPM-C-His)

PV045516 500 ng
EUR 329

Usp45 3'UTR Luciferase Stable Cell Line

TU121679 1.0 ml Ask for price

USP45 3'UTR GFP Stable Cell Line

TU078011 1.0 ml
EUR 2333

Usp45 3'UTR GFP Stable Cell Line

TU171679 1.0 ml Ask for price

Usp45 3'UTR Luciferase Stable Cell Line

TU222950 1.0 ml Ask for price

USP45 3'UTR Luciferase Stable Cell Line

TU028011 1.0 ml
EUR 2333

Usp45 3'UTR GFP Stable Cell Line

TU272950 1.0 ml Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

From March 2019 by way of August 2020, 350 patients had been assessed for eligibility, 323 met inclusion/exclusion standards, and 305 (94%) enrolled, together with 228 NHW, 30 AA, and 47 H/L, with 94%, 100%, and 94% participation charges, respectively. A excessive share of contributors have donated blood (87%), pancreatic tumor tissue (41%), computed tomography scans (76%), and questionnaires (62%).  This biorepository addresses a vital hole in PaCa analysis and has potential to advance translational research meant to decrease disparities and cut back PaCa-related morbidity and mortality.

Studying host genetic background effects on multimorbidity of intestinal cancer development, type 2 diabetes and obesity in response to oral bacterial infection and high-fat diet using the collaborative cross (CC) lines

Studying host genetic background effects on multimorbidity of intestinal cancer development, type 2 diabetes and obesity in response to oral bacterial infection and high-fat diet using the collaborative cross (CC) lines

Multimorbidity of intestinal cancer (IC), type 2 diabetes (T2D) and obesity is a posh set of ailments, affected by environmental and genetic threat components. High-fat diet (HFD) and oral bacterial infection play essential roles in the etiology of these ailments by way of irritation and numerous organic mechanisms.  To research the complexity of this multimorbidity, we used the collaborative cross (CC) mouse genetics reference inhabitants. We aimed to research the multimorbidity of IC, T2D, and obesity using CC lines, measuring their responses to HFD and oral bacterial infection.

The research used 63 mice of each sexes generated from two CC lines (IL557 and IL711). For 12 weeks, experimental mice have been maintained on particular dietary regimes mixed with co-infection with oral micro organism Porphyromonas gingivalis and Fusobacterium nucleatum, whereas management teams weren’t contaminated. Body weight (BW) and outcomes of a intraperitoneal glucose tolerance check (IPGTT) have been recorded at the finish of 12 weeks, after which size and dimension of the intestines have been assessed for polyp counts. Polyp counts ranged between 2 and 10 per CC line.

The mixture of HFD and infection considerably diminished (P < .01) the colon polyp dimension of IL557 females to 2.5 cm2, in contrast to the different teams. Comparing BW achieve, IL557 males on HFD gained 18 g, whereas the females gained 10 g below the similar situations and confirmed the highest space below curve (AUC) values of 40 000-45 000 (min mg/dL) in the IPGTT. The outcomes present that mice from completely different genetic backgrounds reply in another way to a excessive fats diet and oral infection in phrases of polyp improvement and glucose tolerance, and this impact is gender associated.

Data have been extracted from the standardized Quality Data Collection Tool (QDACT). Adults with pancreatic cancer seen by a palliative care supplier have been included. Descriptive statistics have been used to describe demographic options, symptom prevalence and burden, in addition to assess affected person prognosis consciousness outlined by congruence or incongruence with supplier estimated prognosis.

Effect of Collaborative Review of Electronic Patient-Reported Outcomes for Shared Reporting in Breast Cancer Patients: Descriptive Comparative Study

Digital monitoring of treatment-related signs and self-reported affected person outcomes is essential for the high quality of care amongst cancer sufferers. As cellular gadgets are ubiquitous these days, the assortment of digital patient-reported outcomes (ePROs) is gaining momentum. So far, information are missing on the modalities that contribute to the amount and high quality of ePROs.  The goal of our research was to examine the utilization of two variations of a subsequently employed cellular app for digital monitoring of PROs and to check our speculation {that a} shared evaluation of signs in patient-physician collaboration has an affect on the quantity of information entries.
 The Consilium Care app engages cancer sufferers to standardize reporting of well-being and treatment-related signs in outpatient settings. For descriptive comparability of the utilization of two barely completely different app variations, information have been obtained from an early breast cancer trial (model 1 of the app, n=86) and an ongoing research together with sufferers with superior illness (model 2 of the app, n=106). In each app variations, sufferers and docs have been allowed to share the info from information entries throughout consultations.  The numbers and varieties of symptom entries, satisfaction with each app variations, and sufferers’ perceived effects throughout consultations have been included for evaluation.
Symptom severity grading was carried out in accordance to the Common Terminology Criteria for Adverse Events (CTCAE) using a horizontal slider and was indicated in descriptive terminology in each apps, whereas a graphical show facilitated the illustration of symptom historical past charts. In whole, 192 sufferers electronically reported 11,437 information entries on well-being and 33,380 information entries on particular person signs. Overall, 628 (of 872 supposed) requested patient-doctor symptom critiques have been carried out in model 2 of the app.
Both the quantity of information entries per affected person and day for well-being (model 1 vs model 2: 0.three vs 1.0; P<.001) and signs (model 1 vs model 2: 1.three vs 1.9; P=.04) appeared considerably elevated in model 2 of the app. Overall satisfaction with each app variations was excessive, though model 2 of the app was perceived to be extra useful in basic. Version 2 of the app, nevertheless, randomly chosen signs that required an in depth and shared common patient-doctor evaluation in order to focus on the assortment and acceptable interpretation concerning consciousness and steerage for severity grading.
Studying host genetic background effects on multimorbidity of intestinal cancer development, type 2 diabetes and obesity in response to oral bacterial infection and high-fat diet using the collaborative cross (CC) lines

Dancing With Health: Quality of Life and Physical Improvements From an EU Collaborative Dance Programme With Women Following Breast Cancer Treatment

Women’s well being has obtained renewed consideration in the previous few years together with well being rehabilitation choices for girls affected by breast cancer. Dancing has usually been considered one enticing possibility for supporting girls’s well-being and well being, however analysis with girls recovering from breast cancer continues to be in its infancy. Dancing with Health is multi-site pilot research that aimed to consider a dance programme for girls in restoration from breast cancer throughout 5 European nations.

A standardized 32 h dance protocol launched a variety of Latin American dances offered inside a sports activities and train framework with influences from dance motion remedy. Fifty-four girls (M age 53.51; SD 7.99) participated in the research who had a breast cancer prognosis <three years, chemotherapy >6 weeks, no indication of metastasis, or scheduled surgical procedure/chemotherapy/radiation remedy for the length of the intervention. Primary consequence information was collected for anthropometric and health measures subsequent to cancer-related high quality of life. T-tests and Wilcoxon signed ranked checks have been used to set up variations pre and publish intervention.

Anti-MIPT3 Antibody

A08944 100ul
EUR 397
Description: Rabbit Polyclonal MIPT3 Antibody. Validated in IF, IHC and tested in Human.

human Albumin Antibody

BF0544 200ul
EUR 376
Description: human Albumin antibody detects endogenous levels of total human Albumin.

Human P16 Antibody

BF0580 200ul
EUR 376
Description: Human P16 antibody detects endogenous levels of total Human P16.

human Splunc2 Antibody

BF0019 200ul
EUR 376
Description: human Splunc2 antibody detects endogenous levels of total human Splunc2.

human VEGF Antibody

E13-a001 100μg
EUR 382

Human IgE antibody

E22NH04-1 100ug
EUR 343

Human P16 Antibody

abx011302-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Human HER2 Antibody

abx023907-100ug 100 ug
EUR 453
  • Shipped within 5-10 working days.

Human Merlin Antibody

abx023908-100ug 100 ug
EUR 453
  • Shipped within 5-10 working days.

Human CRP Antibody

abx023919-10ml 10 ml
EUR 356
  • Shipped within 5-10 working days.

Human IgM Antibody

abx015702-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

human Splunc2 Antibody

abx015999-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Human IgA Antibody

abx019197-1mg 1 mg
EUR 565
  • Shipped within 5-10 working days.

Human IgG Antibody

abx019200-5mg 5 mg
EUR 230
  • Shipped within 5-10 working days.

Human IgA Antibody

abx234075-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human IgA Antibody

abx234076-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human IgG Antibody

abx234077-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Albumin antibody

70R-7567 1 mg
EUR 140
Description: Affinity purified Goat polyclonal Human Albumin antibody

Human PPP2R1A Antibody

35179-05111 150 ug
EUR 261

Human Cystathionase Antibody

35613-05111 150 ug
EUR 261

Human Amisyn Antibody

35627-05111 150 ug
EUR 261

Human PDCL3 Antibody

35628-05111 150 ug
EUR 261

Human LRP2BP Antibody

35629-05111 150 ug
EUR 261

Human Enterokinase Antibody

35631-05111 150 ug
EUR 261

Human GAD67 Antibody

35633-05111 150 ug
EUR 261

Human CYB5R3 Antibody

35634-05111 150 ug
EUR 261

Human CD37 Antibody

35636-05111 150 ug
EUR 261

Human SH3GL3 Antibody

35637-05111 150 ug
EUR 261

Human XRCC2 Antibody

35678-05111 150 ug
EUR 261

Human EEF1A1 Antibody

35679-05111 150 ug
EUR 261