Virtual Learning Collaboratives (VLC), studying communities centered on a widespread objective, are used incessantly in healthcare settings to implement finest practices. Yet, there may be restricted analysis testing the effectiveness of this strategy in contrast to different implementation strategies. This study evaluates the effectiveness of a VLC in contrast to Technical Assistance (TA) amongst neighborhood oncology practices implementing ENABLE (Educate, Nurture, Advise, Before Life Ends), an evidence-based, early palliative care telehealth, psycho-educational intervention for patients with newly identified advanced cancer and their caregivers.
Using Reach, Effectiveness, Adoption, Implementation, Maintenance (RE-AIM) and Proctor’s Implementation Outcomes Frameworks, this two-arm hybrid type-III cluster-randomized controlled trial (RCT) will evaluate two implementation strategies, VLC versus TA, among the many 48 National Cancer Institute Community Oncology Research Program (NCORP) observe clusters that haven’t traditionally supplied palliative care to all patients with advanced cancer. Three cohorts of observe clusters shall be randomized to the study arms. Each observe cluster will recruit 15-27 patients and a household caregiver to take part in ENABLE.
The main study consequence is ENABLE uptake (affected person degree), i.e., the proportion of eligible patients who full the ENABLE program (obtain a palliative care evaluation and full the six ENABLE classes over 12 weeks). The secondary consequence is general program implementation (observe cluster degree), as measured by the General Organizational Index at baseline, 6, and 12 months. Exploratory goals assess affected person and caregiver temper and high quality of life outcomes at baseline, 12, and 24 weeks. Practice cluster randomization will search to maintain the proportion of rural practices, observe sizes, and minority patients seen inside every observe
This study will advance the sphere of implementation science by evaluating VLC effectiveness, a generally used however understudied, implementation technique. The study will advance the sphere of palliative care by constructing the capability and infrastructure to implement an early palliative care program in neighborhood oncology practices. The LARS rating is an internationally well-accepted questionnaire to assess low anterior resection syndrome, however at the moment there isn’t any formally validated Italian model.
The English model of the LARS rating was translated into Italian following the forward-and-back translation course of. A whole of 147 patients crammed out our model. Among them, 40 patients answered the questionnaire twice for the test-retest reliability part. The validity of the LARS rating was examined utilizing convergent and discriminant validity indicators by correlating the EORTC QLQ-C30 and QLQ-CR29 questionnaires. The LARS rating functionality to differentiate teams of patients with totally different demographic or medical options was additionally assessed.
Performance Characteristics of the Ultrasound Strategy throughout Incidence Screening within the UK Collaborative Trial of Ovarian Cancer Screening (UKCTOCS)
Randomised controlled trials of ovarian cancer (OC) screening haven’t but demonstrated an affect on illness mortality. Meanwhile, the screening information from medical trials represents a wealthy useful resource to perceive the efficiency of modalities used. We report right here on incidence screening within the ultrasound arm of UKCTOCS. 44,799 of the 50,639 girls who had been randomised to annual screening with transvaginal ultrasound attended annual incidence screening between 28 April 2002 and 31 December 2011. Transvaginal ultrasound was used each as the primary and the second line check. Participants had been adopted up by way of digital well being report linkage and postal questionnaires.
Out of 280,534 annual incidence screens, 960 girls underwent screen-positive surgical procedure. 113 had ovarian/tubal cancer (80 invasive epithelial). Of the screen-detected invasive epithelial cancers, 37.5% (95% CI: 26.9-49.0) had been Stage I/II. An extra 52 (50 invasive epithelial) had been identified inside one yr of their final display screen. Of the 50 interval epithelial cancers, 6.0% (95% CI: 1.3-16.5) had been Stage I/II. For detection of all ovarian/tubal cancers identified inside one yr of display screen, the sensitivity, specificity, and optimistic predictive values had been 68.5% (95% CI: 60.8-75.5), 99.7% (95% CI: 99.7-99.7), and 11.8% (95% CI: 9.8-14) respectively.
When the evaluation was restricted to invasive epithelial cancers, sensitivity, specificity and optimistic predictive values had been 61.5% (95% CI: 52.6-69.9); 99.7% (95% CI: 99.7-99.7) and 8.3% (95% CI: 6.7-10.3), with 12 surgical procedures per display screen optimistic. The low sensitivity coupled with the advanced stage of interval cancers means that ultrasound scanning as the primary line check may not be appropriate for inhabitants screening for ovarian cancer. Trial registration: ISRCTN22488978. Registered on 6 April 2000.

The Florida Pancreas Collaborative Next-Generation Biobank: Infrastructure to Reduce Disparities and Improve Survival for a Diverse Cohort of Patients with Pancreatic Cancer
Well-annotated, high-quality biorepositories present a priceless platform to assist translational analysis. However, most biorepositories have poor illustration of minority teams, limiting the power to deal with well being disparities. Methods: We describe the institution of the Florida Pancreas Collaborative (FPC), the primary state-wide potential cohort study and biorepository designed to deal with the upper burden of pancreatic cancer (PaCa) in African Americans (AA) in contrast to Non-Hispanic Whites (NHW) and Hispanic/Latinx (H/L).
We present an overview of stakeholders; study eligibility and design; recruitment strategies; customary working procedures to accumulate, course of, retailer, and switch biospecimens, medical photographs, and information; our cloud-based information administration platform; and progress relating to recruitment and biobanking. Results: The FPC consists of multidisciplinary groups from fifteen Florida medical establishments.
USP45 Polyclonal Antibody |
ES7798-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against USP45 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
USP45 Polyclonal Antibody |
ES7798-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against USP45 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
USP45 Rabbit pAb |
A5074-100ul |
Abclonal |
100 ul |
EUR 308 |
USP45 Rabbit pAb |
A5074-200ul |
Abclonal |
200 ul |
EUR 459 |
USP45 Rabbit pAb |
A5074-20ul |
Abclonal |
20 ul |
Ask for price |
USP45 Rabbit pAb |
A5074-50ul |
Abclonal |
50 ul |
Ask for price |
USP45 antibody |
70R-21212 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal USP45 antibody |
USP45 Antibody |
35125-100ul |
SAB |
100ul |
EUR 252 |
USP45 Antibody |
35125-50ul |
SAB |
50ul |
EUR 187 |
USP45 Antibody |
42822-100ul |
SAB |
100ul |
EUR 252 |
USP45 Antibody |
1-CSB-PA070065 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
USP45 Antibody |
1-CSB-PA693911 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
USP45 Antibody |
1-CSB-PA741097LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
USP45 Antibody |
1-CSB-PA797784 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
USP45 Antibody |
DF4595 |
Affbiotech |
200ul |
EUR 304 |
Description: USP45 Antibody detects endogenous levels of total USP45. |
USP45 Antibody |
CSB-PA226027- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
USP45 Antibody |
CSB-PA226027-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
USP45 Antibody |
1-CSB-PA025737GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Anti-USP45 Antibody |
A09878 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal USP45 Antibody. Validated in WB and tested in Human. |
USP45 Conjugated Antibody |
C42822 |
SAB |
100ul |
EUR 397 |
anti- USP45 antibody |
FNab09335 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:50-1:500
- Immunogen: ubiquitin specific peptidase 45
- Uniprot ID: Q70EL2
- Gene ID: 85015
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against USP45 |
Anti-USP45 antibody |
STJ27068 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. |
Anti-USP45 antibody |
STJ96207 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to USP45. |
USP45 siRNA |
20-abx939237 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
USP45 siRNA |
20-abx939238 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-USP45 |
YF-PA26759 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to USP45 |
USP45 Antibody, HRP conjugated |
1-CSB-PA741097LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
USP45 Antibody, FITC conjugated |
1-CSB-PA741097LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
USP45 Antibody, Biotin conjugated |
1-CSB-PA741097LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USP45. Recognizes USP45 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
USP45 Blocking Peptide |
DF4595-BP |
Affbiotech |
1mg |
EUR 195 |
USP45 cloning plasmid |
CSB-CL741097HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 870
- Sequence: atgcgggtgaaagatccaactaaagctttacctgagaaagccaaaagaagtaaaaggcctactgtacctcatgatgaagactcttcagatgatattgctgtaggtttaacttgccaacatgtaagtcatgctatcagcgtgaatcatgtaaagagagcaatagctgagaatctgtg
- Show more
|
Description: A cloning plasmid for the USP45 gene. |
Anti-USP45 (1H2) |
YF-MA11709 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to USP45 |
Mouse USP45 shRNA Plasmid |
20-abx978800 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human USP45 shRNA Plasmid |
20-abx963755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
USP45 Recombinant Protein (Rat) |
RP236123 |
ABM |
100 ug |
Ask for price |
USP45 Recombinant Protein (Human) |
RP034135 |
ABM |
100 ug |
Ask for price |
USP45 Recombinant Protein (Mouse) |
RP183461 |
ABM |
100 ug |
Ask for price |
Ubiquitin Specific Peptidase 45 (USP45) Antibody |
20-abx116446 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody |
abx027390-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody |
abx027390-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody |
20-abx003878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody |
abx219223-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody |
20-abx212584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody |
20-abx212585 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody |
abx239335-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody |
abx331224-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Ubiquitin carboxyl-terminal hydrolase 45 (USP45) Antibody |
20-abx327313 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody |
20-abx301435 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Usp45 ORF Vector (Mouse) (pORF) |
ORF061155 |
ABM |
1.0 ug DNA |
EUR 506 |
Usp45 ORF Vector (Rat) (pORF) |
ORF078709 |
ABM |
1.0 ug DNA |
EUR 506 |
USP45 ORF Vector (Human) (pORF) |
ORF011379 |
ABM |
1.0 ug DNA |
EUR 95 |
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody (HRP) |
20-abx307782 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody (FITC) |
20-abx307783 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin Carboxyl-Terminal Hydrolase 45 (USP45) Antibody (Biotin) |
20-abx307784 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Usp45 sgRNA CRISPR Lentivector set (Rat) |
K6312801 |
ABM |
3 x 1.0 ug |
EUR 339 |
USP45 sgRNA CRISPR Lentivector set (Human) |
K2601401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Usp45 sgRNA CRISPR Lentivector set (Mouse) |
K4552901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Usp45 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6312802 |
ABM |
1.0 ug DNA |
EUR 154 |
Usp45 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6312803 |
ABM |
1.0 ug DNA |
EUR 154 |
Usp45 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6312804 |
ABM |
1.0 ug DNA |
EUR 154 |
USP45 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2601402 |
ABM |
1.0 ug DNA |
EUR 154 |
USP45 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2601403 |
ABM |
1.0 ug DNA |
EUR 154 |
USP45 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2601404 |
ABM |
1.0 ug DNA |
EUR 154 |
Usp45 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4552902 |
ABM |
1.0 ug DNA |
EUR 154 |
Usp45 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4552903 |
ABM |
1.0 ug DNA |
EUR 154 |
Usp45 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4552904 |
ABM |
1.0 ug DNA |
EUR 154 |
USP45 Protein Vector (Mouse) (pPB-C-His) |
PV244618 |
ABM |
500 ng |
EUR 1065 |
USP45 Protein Vector (Mouse) (pPB-N-His) |
PV244619 |
ABM |
500 ng |
EUR 1065 |
USP45 Protein Vector (Mouse) (pPM-C-HA) |
PV244620 |
ABM |
500 ng |
EUR 1065 |
USP45 Protein Vector (Mouse) (pPM-C-His) |
PV244621 |
ABM |
500 ng |
EUR 1065 |
USP45 Protein Vector (Rat) (pPB-C-His) |
PV314834 |
ABM |
500 ng |
EUR 603 |
USP45 Protein Vector (Rat) (pPB-N-His) |
PV314835 |
ABM |
500 ng |
EUR 603 |
USP45 Protein Vector (Rat) (pPM-C-HA) |
PV314836 |
ABM |
500 ng |
EUR 603 |
USP45 Protein Vector (Rat) (pPM-C-His) |
PV314837 |
ABM |
500 ng |
EUR 603 |
USP45 Protein Vector (Human) (pPB-C-His) |
PV045513 |
ABM |
500 ng |
EUR 329 |
USP45 Protein Vector (Human) (pPB-N-His) |
PV045514 |
ABM |
500 ng |
EUR 329 |
USP45 Protein Vector (Human) (pPM-C-HA) |
PV045515 |
ABM |
500 ng |
EUR 329 |
USP45 Protein Vector (Human) (pPM-C-His) |
PV045516 |
ABM |
500 ng |
EUR 329 |
Usp45 3'UTR Luciferase Stable Cell Line |
TU121679 |
ABM |
1.0 ml |
Ask for price |
USP45 3'UTR GFP Stable Cell Line |
TU078011 |
ABM |
1.0 ml |
EUR 2333 |
Usp45 3'UTR GFP Stable Cell Line |
TU171679 |
ABM |
1.0 ml |
Ask for price |
Usp45 3'UTR Luciferase Stable Cell Line |
TU222950 |
ABM |
1.0 ml |
Ask for price |
USP45 3'UTR Luciferase Stable Cell Line |
TU028011 |
ABM |
1.0 ml |
EUR 2333 |
Usp45 3'UTR GFP Stable Cell Line |
TU272950 |
ABM |
1.0 ml |
Ask for price |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
From March 2019 by way of August 2020, 350 patients had been assessed for eligibility, 323 met inclusion/exclusion standards, and 305 (94%) enrolled, together with 228 NHW, 30 AA, and 47 H/L, with 94%, 100%, and 94% participation charges, respectively. A excessive share of contributors have donated blood (87%), pancreatic tumor tissue (41%), computed tomography scans (76%), and questionnaires (62%). This biorepository addresses a vital hole in PaCa analysis and has potential to advance translational research meant to decrease disparities and cut back PaCa-related morbidity and mortality.